TABLE 1

Primers used in PCR for full-length sequencing of Apricot pseudo-chlorotic leaf spot virus

Primer namePrimer sequence (5′ to 3′)Locus (nucleotides)aExpected size (bp)
F210GAGGAAGAATTGAAGGTGAAC210–2301,795
R2004GATTTGCAAGTCCTTCGACC2004–1985
F1950GGTTTCAAATCAAATGGTGAGG1950–19711,435
R3384CTACCAAAATGCCCCTTGAC3384–3365
F2429GGAGTGTTATGATGATGATGG2429–24491,735
R4163GAGTGGGACTGATGACATG4163–4145
F3865CAGCATGATAGAGAAGGAGC3865–38842,007
R5871CTGAGTCCTTGATGTCCTC5871–5853
F5414GCTGGAGATGATATGTGTGC5414–54331,182
R6595GCTGTAGACCTAACGTCAG6595–6577
F5901CCAATGACTGAAATCAACCAG5901–59211,521
R7421CTCCTTTGATAAACTGGGAC7421–7396
  • a Locus based on complete genome of APCLSV BC isolate (GenBank accession number KY310579).