TABLEĀ 1

Primers used in RT-PCR to amplify the complete genome of Cucurbit aphid-borne yellow virus

Primer namePrimer sequenceProduct size (nucleotides)
CABYVF1ACAAAAGATACGAGCGGGTGA665
CABYVR1GCAAGTCGCCAAAAATCCAA
CABYV F2AGAGAGTCTGCTCCACGTGA1,099
CABYV R2GAGACTGTGCGTCTCCACTT
CABYV F3CGACCGCCGAAACAACCG1,168
CABYVR3TGCTCATCCGTAGACAAGCC
CABYVF4AACAAGCGCGAGATAGCGTT998
CABYVR4CGCCTCCCTGCATTTTGATT
CABYVCP5ATGAATACGGCCGCGGCTAGAAATC600
CABYVCP5CTATTTCGGGTTCTGGACCTGGCA
CABYVF6AACGGATCTTCCTCGGTTGC1,320
CABYVR6CACTTTCTCGTCTCTTCGTC
CABYV F7CACAGCCCACCCGGACTATA544
CABYVR7ACACCGAAACGCCAGGGG