Complete Genome Sequences of Three Xanthomonas citri Strains from Texas

GENOME ANNOUNCEMENT

Xanthomonas citri subsp. citri and Xanthomonas fuscans subsp. aurantifolii cause identical canker disease symptoms on citrus hosts (1). All pathogenic strains of both species inject a common type III effector (TTE), PthA, into host cells (2). Strains of X. citri subsp. citri are subdivided into pathotypes A, A*, and A^w (3). The A^W pathotype is characterized by virulence on lime, determined by the TTEs XopF1 and AvrGF1 (4).

Citrus canker disease was eradicated from Texas in the 1940s. Three Xanthomonas strains (160042, 160149, and 160197) were recently isolated from lime trees exhibiting citrus canker symptoms in Texas. PacBio sequencing was used to obtain the complete genomes of these strains, which were 5,330,822 bp, 5,341,733 bp, and 5,337,252 bp in size with 419×, 393×, and 144 × coverage, respectively. Assemblies were performed using SMRT Portal version 2.3 (Pacific Biosciences, Menlo Park, CA), and annotations were generated using PROKKA (5).

The three genomes revealed average nucleotide identity (ANI) values (6, 7) of >99% compared to X. citri subsp. citri strains 306A and A^W. Mauve analyses (8) revealed that the highest genome similarities were to A^W. The TTE repertoire and lipopolysaccharide (LPS) genes of the Texan strains were identical to those described in X. citri subsp. citri pathotype A^W, including TTEs avrGF1 and xopF1 (4).

Strains 160042 and 160197 had 2 plasmids each, and strain 160149 had 3 plasmids. One of the plasmids in all three strains was large (>123,557 bp) and nearly identical in sequence (>99% ANI) in all three strains. BLASTN (9) revealed high levels of extensive identity with contigs from multiple partial genomes of strains identified as both X. citri subsp. citri and as Xanthomonas axonopodis pv. manihotis. X. axonopodis pv. manihotis is not a pathogen of citrus but causes bacterial blight of cassava. The X. citri subsp. citri strain 160042 large plasmid revealed 99% identity with contigs from both X. citri subsp. citri strain NCPPB 3562, isolated in India from lemon, and X. axonopodis pv. manihotis strain UG21, isolated from cassava in Uganda (10), with 85% and 82% query coverage, respectively. Of note, the plasmids contained a region of ca. 39 kb identified by T346Hunter (11) as similar to type 4 conjugational transfer genes, indicating the potential for horizontal transfer. No genes encoding potential effectors were identified on any of these plasmids. Three primer sets found useful for identifying this plasmid were GAGGACGGGAGGTATGTCCT and AACTCGATGTTGGCTCCCAG, CGGCTACCTCGAAGGATTGG and TTGGTGATTCGTCCTGCTCC, and ACGGAGGTCGGTAAGGAAGT and CTCGGCACACCGTAGATGAA.

All previously described strains of either X. citri subsp. citri or X. fuscans subsp. aurantifolii that cause citrus canker encode PthA, a TTE protein with 17.5 tandem, nearly identical, 34-amino-acid (aa) direct repeats (12). Unusually, none of the homologs found in the Texan strains carried 17.5 repeats, but instead, each strain carried one 18.5 repeat version and either a 19.5 or a 14.5 tandem repeat version. Based on the transcription activator-like (TAL)-TTE effector code (13), the 18.5 repeat variants were all predicted to bind genomic target(s) nearly identical to those of the other known functional PthA orthologs, suggesting that these variants represent functional copies of PthA. Also unusually, 160042 and 160197 encoded the predicted functional orthologs on their chromosomes.